Preview - Central Dogma

Designing experiments

Different versions of the MC1R gene determine what type of melanin gets made.  The most common MC1R version codes for eumelanin (brown hair), but there are specific regions in the DNA sequence that are changed to make pheomelanin (red hair) or a non-functional protein.  One of those regions contains this sequence of DNA: 

CACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACA

 

Questions

Please answer the questions below.

SAQ: Design an experiment that uses this model to investigate how a replication error in MC1R could affect hair color. Write your experimental design here (what precise steps will you follow?)

Write a hypothesis for your experiment. What do you think will happen when there's a replication error, and why? (use the "if...then...because..." format if that helps)

Perform your experiment. Collect evidence using a google doc. Save it as a pdf file on your computer. Upload your evidence file here.

Upload files that are less than 5MB in size.
File Delete

Write the conclusion of your experiment.  What did you find out? Was your hypothesis supported or should we reject it?  

SAQ: Explain how replication error in the MC1R gene could change the hair color of a person using specific evidence from your experiment.

SAQ: Based on the information from this model and information about the MC1R gene, in your own words, what is a gene?

Optional: Human DNA polymerase is very good at copying DNA.  It usually only makes a mistake in 1 out of every 100,000 nucleotides (an error rate of 0.001%!  For context, though, there are about 3 billion basepairs of DNA in each of your cells) AND there are other enzymes in the cell that look for mistakes and fix them.  This means that it's very unlikely that every person with red hair has had a mutation that changes their hair from brown to red.  If that's true, how are there people with red hair?

Notes

These notes will appear on every page in this lesson so feel free to put anything here you'd like to keep track of.